:true:
The Power of Precision
false
us
ZenoTOF 7600 system
TripleTOF 6600+ system
X500R system
X500B system
View all
SelexION device
SCIEX 7500 system
SCIEX Triple Quad 6500+ system
SCIEX 5500+ system
QTRAP 6500+ system
QTRAP 4500 system
Citrine system
4500MD system
Jasper system
View all mass spectrometers
Echo MS system
Biologics Quant solution
Biotransform solution
MPX 2.0 High Throughput Multiplexing system
OptiFlow Quant solution
View all integrated solutions
BioPhase 8800 system
CESI 8000 Plus system
PA 800 Plus system
P/ACE MDQ Plus system
GenomeLab GeXP system
View all capillary electrophoresis
Advance your research with front-end instruments designed to help you realize the full power of your mass spectrometer. SCIEX has the broadest portfolio of ESI-MS front-ends that can facilitate various flow rates, sample requirements and sensitivities. No one else offers the entire range of analytical flow, microflow, nanoflow LC-MS and even ultra-low flow CESI-MS.
ExionLC 2.0 series
Micro HPLC columns
M5 MicroLC system
View All
NanoLC 400 system
Ultra-low Flow CESI-MS
View all front-end HPLC MS
Differential mobility spectrometry (DMS) and ion mobility spectrometry are analytical techniques used to separate ions based on their gas phase mobility. Multiple types of ion mobility devices exist, such as drift tubes, traveling wave, and high-field asymmetric waveform devices. Learn how you can separate yourself with Differential Ion Mobility.
The latest ion sources from SCIEX enable enhanced sensitivity and robustness with greater desolvation range across all MS platforms, from Triple Quad to QTRAP and QTOF.
Turbo V ion source
OptiFlow Turbo V ion source
OptiFlow Interface
View all ion sources
vMethod applications are pre-configured and verified LC-MS/MS methods that reduce the need for method development – significantly cutting the time, effort and money to deploy a new assay. Every vMethod provides method conditions, recommended sample prep, LC and MS conditions, and details for applicable MS/MS library databases for key applications.
AA45/20 1.0
aTRAQ
Illicit drugs
Acrylamide
Allergens
Antiobiotics/veterinary drugs
Cannabinoids
Illegal dyes
Melamine
Mycotoxins
Pesticides
Industrial chemicals (bisphenol)
Industrial chemicals (ethanolamines)
Pesticides (herbicides)
Pesticides (Polar)
Pharmaceutical and personal care products (PPCPs)
Peptide and protein bioanalysis
Routine biologics characterization
Benzodiazepines
Blood screening
Drugs of abuse
Etg and ets
Nicotine
THC-COOH
Urine screening
Explore vMethod applications
Software navigator tool
Free software trials
Software downloads
Software activation
Software support policy
Software support plans
Software feature request portal
Analyst software
Analyst TF software
SCIEX OS software
Biologics explorer software
Cliquid software
DiscoveryQuant software
Molecule profiler software
OneOmics suite
Keystone software
View all software
High resolution and QTRAP libraries can dramatically enhance the quality of your analysis, giving you much improved confidence in your data. With a comprehensive library at your fingertips, you can easily create methods and process targeted and non-targeted screening data on your complex samples, faster and easier than ever before.
All in one library
SCIEX all-in-one HR-MS/MS library with NIST 2017
Antiobiotic Llbrary
Flurochemical library
Forensic library
Mycotoxin library
Natural products
Pesticide library
Wiley Libraries
Antibiotic library
Meta library
Explore the library selector tool
Boost the performance of your mass spectrometer and improve sensitivity, productivity, and data precision. iChemistry Solutions are the world's only reagents and consumables that are custom designed with your success in mind.
RNA 9000 Purity & Integrity kit
aTRAQ kit for amino acid analysis of hydrolysates
aTRAQ kit for amino acid analysis of physiological fluids
Automated protein digestion solution
Biologics analysis kit for CE-SDS
Chemical standard kits
CYP450 protein assay - human induction kit
CZE rapid charge variant analysis kit
Fast glycan analysis and labeling for the PA 800 plus
iDQuant standards kit for pesticide analysis
Lipidyzer platform kits
roQ auEChERS extraction and dispersive kit
Ampliflex diene reagent
Ampliflex keto reagent
Cleavable ICAT reagent
iTRAQ reagent
mTRAQ reagent
View all consumables
QTOF – Quadrupole Time of Flight
QTRAP® – Triple Quad Linear Ion Trap
SWATH® – Data Independent Acquisition
SelexION® – Differential Mobility Separation
MicroLC – Microflow Chromatography
Ultra Low-Flow CESI-MS Technology
iCIEF-MS Technology
Nominal Mass LC-MS-MS
Acoustic Ejection Mass Spectrometry
View All Technology
From substantiating new discoveries through to end-to-end validated workflows for high-throughput biomarker testing in the clinic, thousands of scientists worldwide depend upon mass spec innovation from SCIEX to advance their work in the fields of clinical, research, omics and diagnostics.
Clinical Omics
Lab Developed Tests
View All Clinical
PFAS
Pesticides & herbicides
PPCP
Disinfection by-products
Soil and biota
Ethanolamine
Synthetic polymers
Exposome
Suspect screening
Nanomaterials
View All Environmental Testing
How do you protect your reputation and meet today’s global food safety standards? Whether you are a commercial lab or a food manufacturer, the quality of your food testing data is vital to your business. SCIEX solutions help you meet maximum residue limits (MRLs) with high-quality data that you can genuinely count upon. With a portfolio of applications, your lab can quickly and easily react to diverse market needs.
Pesticide Testing
Mycotoxins Testing
Antibiotics Testing
Potency Testing
Mycotoxin Testing
Terpenes Profiling
Meat Speciation Testing
Food Fraud Analysis
Food Adulterant Testing
Food Dye Testing
Food Omics
Allergen Testing
Ingredient Authenticity & Profiling Analysis
Packaging & Food Contact Substance Analysis
View All Food and Beverage Testing
How do you ensure the integrity of your results in an industry that is never constant? By accurately detecting even the smallest compound angles you can deliver evidence that stands. SCIEX forensic analysis solutions deliver fast, highly accurate data across a multitude of compounds and biomarkers, from the known to the new and novel.
Forensic Drug Testing
Designer Drug Testing
View All Forensics Testing
Discovery Proteomics
Next-Generation Proteomics
Targeted Proteomics
Discovery Lipidomics
Targeted Lipidomics
Discovery Metabolomics
Targeted Metabolomics
OneOmics
Gene Expression Analysis
DNA Sequencing
Genotyping and SNP Analysis
STR Analysis
AFLPs
View All Life Science Research
Transform the capacity and capability of your biologics pipeline with complete end-to-end solutions that make your lab more productive, and more successful. With a longstanding track record in pharma discovery, development and manufacturing, our unparalleled application knowledge with best-in-class hardware, software and support all integrate to revolutionize your lab.
Small Molecule Quant
Peptide Protein Quant
Oligonucleotide Quant
Comprehensive Metabolite Identification
Biotherapeutic Catabolism
Native Mode Analysis
High Throughput ADME
Intact Protein Analysis
Peptide Mapping
Protein Glycosylation/Microhetrogeneity
Purity/Heterogeneity Analysis
Identity/Charge Heterogeneity
Host Cell Proteins
Capsid Analysis
Nucleic Acid and Plasmid Analysis
SNP Analysis
Gene Expression Profiling
View All Pharma and Biopharma
Citrine™ Mass Spec
4500MD Mass Spec
Jasper™ HPLC System
Analyst® MD Software
Cliquid® MD Software
MultiQuant™ MD Software
ClearCore™ MD Software
Clinical Mass Spec Operators
Clinical Method Developers
Clinical Lab Managers
View All Diagnostics
The SCIEX Now Learning Hub offers the most diverse and flexible learning options available, with best-inclass content that helps you to get the most out of your instrument and take your lab to the next level. Available personalized learning paths based on the latest memory science ensure better knowledge retention, and automated onboarding and enrollment means you’ll get up and running faster.
SCIEX Now Learning Hub offers the most diverse and flexible learning options available, with best-in-class content that helps you to get the most out of your instrument and take your lab to the next level. Available personalized learning paths based on the latest memory science ensure better knowledge retention, and automated onboarding and enrollment means you’ll get up and running faster.
SCIEX Learning Manager provides you with the infrastructure to assign, monitor and report on your staff's competency through a single digital platform. Effectively manage the training process for new hires, ensure continuous staff development and access information with a single log-in to your SCIEX account.
You can browse, filter, or search our extensive list of training offerings. Choose from over 100 self-paced eLearnings or search for an instructor-led course near you. Once you select the course you want to take, you will be directed to Learning Hub for enrollment (login required).
SCIEX Now Online is the Everything, Anytime destination for all your SCIEX support needs. You can keep track of activities that matter most to you and manage your lab in the most efficient way possible. Extensive self-help resources like our deep Knowledge Base, enable you to solve many problems on your own. SCIEX Now is available 24/7 and your new SCIEX instruments are automatically added to your profile when you purchase.
Support Cases
SCIEX Now Learning Hub
Instruments
Manage My Instruments
Registered Software
Activate Software
Resource Library
My Notifications
Request Support
Course Catalog
Software Downloads
SCIEX Store
SCIEX Now New Feature Request
Software New Feature Request
Online ordering solutions
Log In
Don't have an account? Create One
Visit your SCIEX Now™ Dashboard
No one understands your needs and can support your systems better than we can. Our mission is to help you be successful, whether it's to repair your instrument, assist with your workflows, or help you maximize productivity in your lab. Whatever your challenge, global SCIEX Service and Support personnel are subject matter experts who are focused on mass spec and capillary electrophoresis, so you'll be able to achieve your scientific goals quickly and efficiently.
LC-MS Service Plans
Protect Plus Suite for Your New LC-MS
CE Service Plans
Clinical Service Plan
StatusScope Remote Monitoring
Laboratory Optimization Services
Compliance Consultancy
Qualification and Validation
On-Site Applications Support
Professional Relocation Services
View All Instrument Service & Support
Software Accelerator Program
Software Support Plans
Software Support Policy
Premium Access Content
View All Support Tools
SCIEX Now Learning Hub is much more than online courses. For the most comprehensive option, you can select Success Programs: personalized, blended online and in-person courses. If your needs are met by a visit from one of our training experts, you can choose multiple Onsite Training days to get your lab running. Visit a SCIEX training center in North America, Europe or Asia for intensive classroom and laboratory training. And your online courses are available any time, from anywhere, right here.
Login to SCIEX Now Learning Hub
Success Programs at Your Site
Online Course Catalog
Clinical Knowledge Center
Application Scientist Training at Your Site
China
Europe
German CE Courses
India
Japan
Korea
North America
UK
Visit all Training
If you have CE, LC or mass spec questions, then SCIEX has the answers. SCIEX support is the single destination for your system questions. We aim to fully assist you with virtually every application of our instruments, helping you to get the most out of your lab resources and assets.
Frequently Asked Questions
View All Request Support
As a life science researcher, you need the tools and support to help you create the scientific foundation in pursuit of expanding the knowledge-base, whether it is understanding fundamental biology, finding new biomarkers, discovering ways to improve our quality of life, or other areas of research. We are committed to the same goals and put the very same dedication into our work to help you address your most significant research challenges.
Academic Partnership Program
Academic Partners
View All Partnership Programs
Regulatory compliance is as paramount for us as it is for you. That’s why we have made it easy for you to freely reference all relevant technical and product regulatory documents. To give you confidence that, with SCIEX, you will fully comply with legislation, adhere to your laboratory protocol and meet industry standards.
Declaration of Conformance
Safety Data Sheets
Certificates of Analysis
View All Regulatory Documents
SCIEX supplies extensive documentation to help you prepare for, use, and maintain your SCIEX hardware and software products, and we update this documentation regularly. On the Customer Documents page, you can search for and download the latest documents for your product.
Customer Documents
Join the SCIEX community today to interact with your peers, share and exchange ideas, develop your knowledge, stay up-to-date with the latest products, post insights and questions, comment on others and receive support. This community is designed to help you, our customers, move science forward and get the answers you need. We’re committed to engaging with and listening to you, to create the best customer experience possible and to contribute to the success of your work.
Biopharma
Clinical
Environmental / Industrial
Food and Beverage
Forensics
Life Science Research
Pharma
Technology
Knowledge Base Articles
SCIEX Now Feature Requests
Software Feature Requests
Newsletter Archive
Featured Content
FAQs
View All Community
About SCIEX
About Danaher
Customer Profiles
Our History
Our favorite papers
Meet our executives
Career opportunities
Contact us
Press releases
In the news
Awards
You've got questions. We've got experts who can help. Contact us to find out more, talk to a specialist, explore our solutions or get expert support.
Talk to a specialist
Request more information
Request a quote
Request support
SCIEX success network
Frequently asked questions
SCIEX community
Request hosted catalog
Request punchout
Global public relations
508-782-9484
Country/Region Canada Mexico United States
Country/Region Argentina Brazil Chile Colombia Costa Rica Ecuador El Salvador Guatemala Peru Uruguay Venezuela
Country/Region Germany Albania Austria Belgium Bosnia and Herzegovina Bulgaria Croatia Cyprus Czech Republic Denmark Estonia Finland France Germany Greece Hungary Ireland Italy Latvia Lithuania Luxembourg Macedonia Montenegro Netherlands Norway Poland Portugal Romania Serbia Slovakia Slovenia Spain Sweden Switzerland United Kingdom
Country/Region Bangladesh Brunei Darussalam Cambodia 中国 Hong Kong India Indonesia 日本 한국 Singapore Sri Lanka Taiwan Thailand Viet Nam
Country/Region Bahrain Iran Iraq Israel Jordan Kuwait Lebanon Oman Pakistan Palestine Qatar Saudi Arabia Syria Turkey United Arab Emirates Yemen
Country/Region Algeria Angola Botswana Burundi Egypt Ethiopia Kenya Liberia Libya Morocco Rwanda South Africa Tunisia Uganda United Republic of Tanzania Zambia Zimbabwe
Country/Region Armenia Azerbaijan Belarus Georgia Kazakhstan Kyrgyzstan Moldova Russia Tajikistan Turkmenistan Ukraine Uzbekistan
Country/Region Australia Micronesia New Zealand
AB Sciex is doing business as SCIEX. © 2010-2018 AB Sciex. The trademarks mentioned herein are the property of the AB Sciex Pte. Ltd. or their respective owners. AB SCIEX™ is being used under license. Beckman Coulter® is being used under license. Product(s) may not be available in all countries. For information on availability, please contact your local representative. For research use only. Not for use in diagnostic procedures.
Download Tech Note (PDF)
Increasing sensitivity for oligonucleotide quantification using the SCIEX Triple Quad™ 7500 LC-MS/MS System – QTRAP ® Ready, powered by SCIEX OS Software
Remco van Soest, Eshani Nandita, Elliott Jones and Kerstin Pohl SCIEX, USA
This technical note describes how the lower limits of quantification (LLOQs) for antisense oligonucleotides (ASOs) in rat plasma are further improved by using a microflow trap-andelute method. Compared to previously published data acquired using analytical flow LC on a SCIEX 7500 System1 , sensitivity was increased by a factor of 20 (see Table 1 for achieved LLOQs). Compared to data with the same microflow method using a QTRAP 6500+ LC-MS/MS System, the sensitivity was improved by a factor of 3. 2
Oligonucleotide therapeutics and gene therapies are rapidly gaining attention as their potency improves and delivery challenges are addressed. Modalities such as ASOs are becoming more important due to their high specificity and ability to reach formerly undruggable targets. Sensitive and robust methods for quantitative analysis of oligonucleotides are needed to support the development of ASO therapeutics. Ligand binding assays using fluorescence detection can achieve very low detection limits. However, linear dynamic range is limited, and this type of assay often cannot differentiate oligonucleotides from their impurities and metabolites. LC-MS/MS can provide excellent selectivity, good sensitivity and the ability to analyze multiple oligonucleotides in a single assay. However, for studies where sample is limited, such as preclinical pharmacodynamic studies in rats or mice, sensitivity can still be insufficient.
Published data shows that the use of microflow LC lowered the LLOQ by an order of magnitude for several ASOs in an LCMS/MS assay using the QTRAP 6500+ System. 3 The use of a trap-and-elute microflow approach allowed injection of large volumes of extracted plasma samples, up to 30 µL, without increasing run times significantly. This technical note describes a further improvement of the LLOQs using the same trap-and-elute microflow method, with the more sensitive SCIEX 7500 System.
Table 1. Lower limits of quantification achieved for different ASOs in rat plasma using a trap-and-elute microflow method and the SCIEX 7500 System.
Samples and reagents: Fomivirsen, nusinersen, eluforsen, a model fully phosphorothioated 2’O-methylated oligonucleotide with the sequence mU*mA*mU*mC*mC*mG*mC*mC*mU*mC*mG*mU*mG*mA*m G*mA*mA*mG*mA*mU and an internal standard with the sequence CATGGTCCTGCTGGAAGTTCGTG were all purchased from IDT. The ion-pairing reagents 1,1,3,3,3- hexafluoroisopropanol (HFIP, ≥ 99.8%) and diisopropylethylamine (DIEA, ≥ 99.5%,) were purchased from Sigma Aldrich. Ethylenediaminetetraacetic acid (EDTA) was also purchased from Sigma Aldrich.
Sample preparation: Calibration curves were prepared by spiking analytes and internal standard (500 ng/mL) in extracted rat plasma (Sprague Dawley, K2 EDTA, BioIVT). 1 mL plasma samples were extracted using Clarity OTX solid phase extraction (SPE) cartridges (Phenomenex) following the manufacturer’s protocol for extracting oligo therapeutics from biological samples. After drying with nitrogen gas at 40°C, the plasma extract was reconstituted in 1 mL mobile phase A containing 100 µM EDTA.
Chromatography: A SCIEX M5 MicroLC System was used in trap-and-elute mode. A separate sleeve-type column oven was used to control the trap column temperature. Gradient and other chromatographic conditions and columns are summarized in Tables 2 and 3. A volume of 30 µL of reconstituted sample was loaded onto the trap column.
Table 2. LC method.
Loading flow rate was 35 µL/min for 2 min, after which the trap valve was switched and the sample eluted onto the analytical column. The analytical gradient was ramped from 5% to 60% mobile phase B in 3 minutes at a flow rate of 5 µL/min. The trap valve was switched back to the load position 3 minutes after the start of the analysis for washing at the loading flow rate.
Table 3. Chromatographic conditions.
Mass spectrometry: A SCIEX 7500 System with an OptiFlow Pro Source with E Lens™ Technology and micro (low) electrode was used in MRM mode. All source and MS parameters were optimized (Tables 4 and 5). The MS method included two MRM transitions for each analyte and one MRM transition for the internal standard (IS).
Table 4. Source conditions.
Data processing: MRM data were processed with SCIEX OS Software 2.0 using the MQ4 integration algorithm.
Table 5. MRM transitions and MS parameters.
Figure 1 shows baseline separation was achieved for the four oligonucleotides and the internal standard. MRM transitions used for the quantification of oligonucleotides and their metabolites/impurities often share the same fragment, and there is possible overlap among the precursors because of the large number of charge states with similar intensities. Therefore, it is important to have good chromatographic separation of all analytes and the internal standard.
Calibration curves were measured in triplicate for all of the analytes by spiking the analytes into plasma extract in the concentration range between 0.01 and 100 ng/mL. Exceptional accuracy and precision were achieved for all analytes (Table 6). LLOQs and linear calibration curve ranges were determined based on the requirements that the %CV of the calculated mean of the concentration is below 20% at the LLOQ and below 15% for all higher concentrations, while the accuracy of the calculated mean is between 80% and 120% at the LLOQ and between 85% and 115% for the higher concentrations.
The LLOQ for eluforsen was found to be 0.03 ng/mL, while the LLOQs for the other oligonucleotides were 0.01 ng/mL. For methyl-oligo, the LLOQ was 20x lower compared to what was previously determined using analytical flow LC 1 , demonstrating the sensitivity improvements achieved by using microflow LC. The calibration curves showed excellent linearity up to 100 ng/mL: for each of the analytes, 3.5 orders or higher of linear dynamic range (LDR) was achieved (Figure 2).
Figure 1. XICs for the MRMs of four ASOs and the IS. Two MRM transitions were used for each analyte, one for the IS. Baseline separation was achieved using a 3 min gradient.
Table 6. Calculated concentration, precision and accuracy for each oligonucleotide at each concentration.
Figure 2. Calibration curves based on IS-adjusted XIC areas for each of the oligonucleotides. LDR for each of the analytes was 3.5 orders or higher.
Figure 3. XICs for the transitions of each analyte. Blanks from extracted plasma (left) and ASOs at their LLOQs (right). No noticeable interference was observed in the matrix blank.
Figure 3 shows the XICs of all analytes for a blank extracted plasma injection (left) and at their LLOQ levels (right). No significant interferences were seen, illustrating efficient clean-up of the plasma matrix using the Clarity OTX SPE cartridges. Carryover was determined to be around 0.5% in the first blank after injecting the upper limit of quantification (ULOQ). This could be further reduced by adding longer column and trap washes if the full linear range is required.
We use cookies to optimize site functionality and give you the best possible experience.