Methods

Samples and reagents: All reagents, including 1,1,1,3,3,3- hexafluoro isopropanol (HFIP)≥ 99.8%, diisopropylethylamine (DIEA) 99.5 % and ethylenediaminetetraacetic acid (EDTA) were purchased from Sigma Aldrich. The customized oligonucleotide standards were synthesized by Integrated DNA Technologies (IDT), including the 20mer analyte of a fully phosphorothioated (*) and 2’O-methylated RNA (m) ASO (mU*mA*mU*mC*mC*mG*mC*mC*mU*mC*mG*mU*mG*mA*m G*mA*mA*mG*mA*mU), the 21mer internal standard (IS) of a fully phosphorothioated ASO (G*C*G*T*T*T*G*C*T*C*T*T*C*T*T*C*T*T*G*C*G), and a carrier oligonucleotide to minimize non-specific binding (CATGGTCCTGCTGGAAGTTCGTG). The Clarity OTX solid phase extraction (SPE) kit was obtained from Phenomenex. Human plasma was purchased from BioIVT.

Sample preparation: 100 μL of human plasma mixed with 100 μL of lysis loading buffer (Clarity OTX kit) was extracted using the Clarity OTX SPE plate following the manufacturer’s protocol. In short, the SPE plate was activated with 1 mL methanol and equilibrated with 1 mL equilibration buffer. After equilibration, human plasma mixed with lysis-loading buffer was loaded onto the plate and washed with 1 mL washing buffer for a total of 3 times and subsequently eluted with 1 mL elution buffer. The eluted samples were dried down with N2 gas at 40 °C and reconstituted in 100 µL mobile phase A (100 mM HFIP and 15 mM DIEA in water) containing 100 μM EDTA. The calibration curve ranging from 0.05 ng/mL to 10,000 ng/mL was prepared by spiking the analyte ASO into extracted human plasma along with 1 µg/mL IS and 2 µg/mL carrier oligonucleotide.

Chromatography: A gradient profile was used at a flow rate of 300 μL/min (Table 1) using an ExionLC™ system equipped with a Waters Acquity BEH C18 column (2.1×50 mm, 1.7 µm, 130Å) . The mobile phase A consisted of water with 15 mM DIEA and 100 mM HFIP, while the organic phase B was 15 mM DIEA and 100 mM HFIP in 90 % methanol (v:v). The column oven temperature was set to 60°C. The injection volume was 20 µL for each system.

Mass spectrometry: On-column method development was performed, as transitions and source/gas parameters are highly dependent on LC-MS conditions. In order to compare the sensitivity difference between the SCIEX QTRAP 6500+ System and SCIEX 7500 System, the calibration curve samples were injected and analyzed in triplicates on both systems with the same MS-dependent parameters, but adjusted source/gas parameters for each instrument. Tables 2-3 summarize the MS parameters that were optimized for each specific hardware configuration. 

Data processing: MRM data were processed by using SCIEX OS Software 2.0. The MQ4 algorithm was used for peak integration.

Quantification results

Investigation of improvements in sensitivity were performed using the same ASO calibration set on the SCIEX QTRAP 6500+ System and the SCIEX 7500 System.

With novel hardware improvements, the presented LC-MRM assay demonstrated ultra-high sensitivity for quantification of ASO in human plasma with the LLOQ at 0.2 ng/mL and LOD at 0.05 ng/mL (Figure 2). On the SCIEX QTRAP 6500+ System, a concentration of 0.2 ng/mL was detectable. Using the SCIEX 7500 System, this level can now be solidly quantified with %CV below 6% for all tested samples (Figure 3). Overall, the SCIEX 7500 System offers a notable 4-fold enhancement in S/N.

Both systems offer an LDR covering 4.5 orders of magnitude (Figure 3 and Figure 4). However, a lower LLOQ is enabled with the SCIEX 7500 System for ASO quantification in matrix with great accuracy and reproducibility for the entire range of concentrations (Figure 3). Therefore, the LC-MRM method provides substantial improvement in monitoring low-level analytes when compared with LBAs and fluorescence-based detection.

SCIEX 7500 System provides innovative hardware designs that facilitate greater ion generation and ion sampling. Improvements feature the OptiFlow Pro Ion Source with E Lens Technology which increases ion generation and the D Jet Ion Guide which enables higher efficient capture and transmission of analyte ions behind the orifice plate.¹ These highlighted features contributed to the observed increase in sensitivity and S/N compared to previous instrument generations. 

Conclusion
 

• An ultra-sensitive LC-MRM method for quantifying a highly modified ASO was demonstrated with a 4-fold enhancement in S/N compared to previous instrument generations
  
  
• Unprecedented sensitivity for ASO quantification with an LLOQ at 0.2 ng/mL in matrix was achieved with the SCIEX 7500 System
  
  
• Exceptional accuracy and reproducibility with an LDR of 4.5 orders of magnitude was obtained
  
  
• High throughput needs are addressed with a method run time of 6 min
  
  
• The high specificity of the presented LC-MS assay allows for simultaneous quantification of multiple closely related species which cannot be achieved with orthogonal assays

References
 

1. Enabling new levels of quantification. SCIEX technical note RUO-MKT-02-11886-A.